PhantomCodeAIPhantomCodeAI
FeaturesMock InterviewJobsPricing
FeaturesMock InterviewJobsPricing
PhantomCodeAIPhantomCodeAI
FeaturesMock InterviewJobsPricing
FeaturesMock InterviewJobsPricing
HomeLeetCode ProblemsRepeated DNA Sequences
Used by thousands of developers who passed their interviews

How to Solve Repeated DNA Sequences Problem

Master the Repeated DNA Sequences LeetCode problem with undetectable real-time assistance. Get instant solutions and explanations during your coding interviews.

PhantomCodeAI generates complete solutions and debugging hints that you can use while explaining your approach, so you stay calm and in control.

undetectable
real-time
works on major platforms
Start Free
Medium#187
LeetCode Problem

Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Hash TableStringBit ManipulationSliding WindowRolling HashHash Function

PhantomCodeAI will help you solve this problem in real-time during your interview

Get instant solutions, explanations, and code generation
Problem Breakdown

Understanding the Repeated DNA Sequences Problem

Let's break down this LeetCode problem and understand what makes it challenging in interview settings.

Problem Statement

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'. When studying DNA, it is useful to identify repeated sequences within the DNA. Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

MediumProblem #187
LeetCode

Repeated DNA Sequences

Related Topics

Hash TableStringBit ManipulationSliding WindowRolling HashHash Function

How PhantomCodeAI Helps

Get real-time assistance for Repeated DNA Sequences problems during coding interviews. PhantomCodeAI provides instant solutions and explanations.

Examples

# Example 1

Input
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output
["AAAAACCCCC","CCCCCAAAAA"]

# Example 2

Input
s = "AAAAAAAAAAAAA"
Output
["AAAAAAAAAA"]

Constraints

1 <= s.length <= 105
s[i] is either 'A', 'C', 'G', or 'T'.

How PhantomCodeAI Helps with LeetCode Problems

Reinforce undetectability, platform compatibility, and real-time assistance to remove any doubt.

1000+
developers use PhantomCodeAI
and growing every day
95%
success rate
of users pass their interviews
100%
undetectable
native desktop architecture
Real-time
assistance
instant solutions during interviews

See PhantomCodeAI in Action

Watch how PhantomCodeAI helps solve LeetCode problems during live interviews

PhantomCodeAI
Start Interview
⌘I
Online Round
⌘O
Hide⌘B
Interview
Listening
Think

Solve Repeated DNA Sequences — The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C',...

Here's the optimal approach using Hash Table:

def solve(input):
# Optimal O(n) solution
return result

Time: O(n)  |  Space: O(n)

Start Over ⌘G
Think & Crack ⌘↵

Undetectability Checklist

Run compatibility test before interviews
Use recommended Zoom version settings
Enable advanced screen capture options
Verify native desktop architecture
Test with screen recording software

Platform Compatibility

Zoom
Supported
Google Meet
Supported
HackerRank
Supported
CodeSignal
Supported
CoderPad
Supported
Teams
Supported

User results and traction

Thousands of developers use PhantomCodeAI. Social proof signals that this approach helps real candidates land offers across a range of companies.

Undetectability and technical details

Our native desktop architecture avoids common detection vectors used by browser extensions. We provide a clear checklist so you can run basic checks and confirm the app will be invisible.

Platform compatibility and limitations

We work with Zoom, HackerRank, CodeSignal, CoderPad and other web-based platforms. Check the compatibility note and request a browser link if a specific desktop app is unsupported.

Frequently Asked Questions

Common questions about solving Repeated DNA Sequences and using PhantomCodeAI during coding interviews.

How does PhantomCodeAI help with LeetCode problems during a coding interview?
PhantomCodeAI reads the problem from a screenshot or listens to it via audio, then generates a complete solution with a step-by-step approach and time/space complexity, so you can focus on explaining your reasoning rather than getting stuck on implementation.
Which programming languages does PhantomCodeAI support?
11 languages including Python, Java, C++, JavaScript, TypeScript, Go, Rust, Ruby, Swift, Kotlin, and C#. Set a preferred language to get idiomatic solutions.
Does PhantomCodeAI work with HackerRank, CodeSignal, and CoderPad?
Yes — it works alongside LeetCode, HackerRank, CodeSignal, CoderPad, and HackerEarth, plus any browser-based coding environment.
Can PhantomCodeAI handle follow-up questions and modifications?
Yes. Capture the modified problem by screenshot or audio and get an updated solution within seconds, including new edge cases and optimizations.
Is PhantomCodeAI detectable during live interviews?
PhantomCodeAI runs as a native desktop overlay that does not appear in screen shares, recordings, or proctoring software, and works with Zoom, Google Meet, Microsoft Teams, and major coding platforms.
Should I still practice these problems on my own first?
Yes. The most durable preparation is solving problems unaided first, then using AI afterward to review your approach, complexity, and missed edge cases — use it to debrief and learn, not to skip the reps.

Related LeetCode Problems

Practice more problems similar to Repeated DNA Sequences.

3Longest Substring Without Repeating CharactersMedium30Substring with Concatenation of All WordsHard76Minimum Window SubstringHard12Integer to RomanMedium13Roman to IntegerEasy17Letter Combinations of a Phone NumberMedium49Group AnagramsMedium67Add BinaryEasy
← PreviousDepartment Top Three SalariesNext →Best Time to Buy and Sell Stock IV
PhantomCodeAI

20+ Stealth Features. Zero Detection Cases.

The only AI interview tool with an undetectable desktop overlay, real-time audio listening, and personalized AI responses.

Start Free
PhantomCodeAIPhantomCodeAI
PhantomCodeAI is an undetectable desktop application to help you pass your Leetcode interviews.
All systems online
Download

Legal

Refund PolicyTerms of ServiceCancellation PolicyPrivacy PolicyAll Policies

Pages

Contact UsHelp CenterInstant SupportFAQBlogFeaturesInterview CopilotCoding CopilotInterview QuestionsPricingMock Interview PricingEarn with UsBest AI Interview Assistants 2026FeedbackLeetcode ProblemsLoginCreate Account

Compare

All 29 comparisons →Why switch (29 alternatives) →Interview Coder AlternativeFinal Round AI AlternativeUltraCode AI AlternativeParakeet AI AlternativeAI Apply AlternativeCoderRank AlternativeInterviewing.io AlternativeShadeCoder Alternative

Resources

Salary GuideResume TemplatesWhat Is PhantomCodeAIIs PhantomCodeAI Detectable?Use PhantomCodeAI in HackerRankvs LeetCode PremiumFor European EngineersFor FAANG Interview PrepPost-Layoff ComebackIndia Pricing (INR)

Interview Types

Coding InterviewSystem Design InterviewDSA InterviewLeetCode InterviewAlgorithms InterviewData Structure InterviewSQL InterviewOnline Assessment

Interview Questions

See all →
GoogleAmazonMetaMicrosoftAppleNetflixStripeUberAirbnbBloombergSoftware EngineerFrontend EngineerBackend EngineerData EngineerML EngineerDevOps EngineerData ScientistEngineering ManagerBehavioralSystem Design

Mock Interview by Round Type

All formats →
Mock Interview HubMock Coding InterviewMock Behavioral InterviewMock System Design

AI for Industry Interviews

All industries →
Sales InterviewsPM InterviewsFinance InterviewsConsulting InterviewsDesign Interviews

Coding Interview Patterns

See all patterns →
Coding Interviews HubDynamic ProgrammingTwo Pointers + Sliding WindowGraph AlgorithmsTree AlgorithmsBinary Search

Interview Guides

See all guides →
How to Ace an InterviewHow to Crack InterviewsBest Interview AnswersScreening Interview QuestionsTelephone Interview TipsWorking Interview ExplainedCracking the PM InterviewFAANG 30-Day RoadmapTop 10 LeetCode PatternsSystem Design Prep GuideSTAR Behavioral MethodBehavioral Interview Qs

Alternatives — why engineers switch

See all 29 →
Interview CoderFinal Round AIParakeet AILockedIn AIUltraCode AIShadeCoderSensei AIVerve AICluelyChatGPTBeyz AIInterview SidekickYoodliAlgoMonsterCoderRankExponentFormationInterviewing.ioInterview CakeBig InterviewInterview KickstartPrampScalerAI ApplyCareerflowJobscanKickresumeTeal HQHireVue

AI Interview Tools

AI Interview AssistantAI Interview CoachAI for Job InterviewsAI Interview Preparation ToolReal-Time AI Interview AnswersInterview AI HelperReal-Time AI Interview AssistantAI Interview BotBest AI Interview Tools 2026AI Interview QuestionsPractice Interview QuestionsAI to Answer Interview QuestionsAI Phone Interview HelpAI Interviewing SoftwareAI Interview HubInterview CopilotAI Coding Interview AssistantMock Interview

More From Us

ResumeWizard — AI Resume BuilderMailBlastr — Email Campaigns

© 2026 PhantomCodeAI. All rights reserved.